View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16994_low_2 (Length: 679)

Name: NF16994_low_2
Description: NF16994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16994_low_2
NF16994_low_2
[»] chr4 (2 HSPs)
chr4 (18-679)||(34748054-34748716)
chr4 (21-232)||(24860293-24860504)
[»] chr8 (6 HSPs)
chr8 (21-478)||(26591665-26592126)
chr8 (27-232)||(43479850-43480055)
chr8 (21-232)||(38799242-38799453)
chr8 (21-232)||(38822064-38822275)
chr8 (21-232)||(25865447-25865658)
chr8 (60-232)||(41943691-41943863)
[»] chr2 (5 HSPs)
chr2 (45-232)||(13576095-13576282)
chr2 (21-232)||(34579084-34579295)
chr2 (21-232)||(34584833-34585044)
chr2 (162-232)||(34571787-34571857)
chr2 (21-100)||(34571616-34571695)
[»] chr5 (4 HSPs)
chr5 (54-232)||(12531239-12531417)
chr5 (54-232)||(12547202-12547380)
chr5 (71-231)||(9866878-9867038)
chr5 (57-151)||(9869843-9869937)
[»] scaffold0197 (1 HSPs)
scaffold0197 (57-232)||(30759-30934)
[»] chr7 (2 HSPs)
chr7 (57-232)||(21317321-21317496)
chr7 (27-232)||(3930137-3930342)
[»] chr1 (1 HSPs)
chr1 (165-232)||(7594910-7594977)


Alignment Details
Target: chr4 (Bit Score: 583; Significance: 0; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 583; E-Value: 0
Query Start/End: Original strand, 18 - 679
Target Start/End: Complemental strand, 34748716 - 34748054
Alignment:
Q  18 accagacgctggaagggaagtttgcggatgaggagttcggtgctcttctggtacttacggatctcacggagagcgacggttcctggcctgaaacggtgag 117  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||    
T  34748716 accagacgctggaaggggagtttgcggatgaggagttcggtgctcttctggtacttacggatctcacgtagagcgacggttcctggtctgaaacggtgag 34748617  T
Q  118 gtttcttcactccaccggtggccggagcagatttgcgagcggcttttgtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttg 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||    
T  34748616 gtttcttcactccaccggtggccggagcagatttgcgagcggcttttgtggctagttgcttccttggagctttacctccagtggatttgcgagcggtttg 34748517  T
Q  218 cttggtacgtgccatagatgctgaaaaataactgagaagaacgttttctagcagaaaagcttgaaggttgttttggtgatttcagattgagagtgatgaa 317  Q
    ||||||||||||||| |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34748516 cttggtacgtgccattgatgctgaaaaataactgagaaaaacggtttctagcagaaaagcttgaaggttgttttggtgatttcagattgagagtgatgaa 34748417  T
Q  318 gaagaagggatgaaagaggtgagttatataatgatatgattttgtgcgggttttgaaatttgagaagagggtgagtggggtgtgattgtggccgttgatt 417  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34748416 gaagaagggatgaaagaggtgagttatataatgatatgattttgtgcgggttttgaaatttgagaagagggtgagtggggtgtgattgtggccgttgatt 34748317  T
Q  418 attggttaatcgacgggtgtcgtttatttggagtttttgcgacacgcggatcgatgacgtggcttgcggatgtgtttggtttgtgtgatgaggatcgttg 517  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  34748316 attggttcatcgacgggtgtcgtttatttggagtttttgcgacacgcggatcgatgacgtggcttgtggatgtgtttggtttgtgtgatgaggatcgttg 34748217  T
Q  518 attttatggttatcgatggttgaaattgaatttcaaagaatcacacggatcggtgacgtggcgtgtagttatggaaagttgaaattgaatttgagaaaat 617  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34748216 attttatggttatcgatggttgaaattgaatttcaaagaatcacgcggatcggtgacgtggcgtgtagttatggaaagttgaaattgaatttgagaaaat 34748117  T
Q  618 ga--cgcggatcgattannnnnnnggagggagaaagtgaaaatgaaaatgaaaataaataaagg 679  Q
    ||  |||||||||||||       ||||||||||||||||||||||||||||||||||||||||    
T  34748116 gacgcgcggatcgatta-ttttttggagggagaaagtgaaaatgaaaatgaaaataaataaagg 34748054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 21 - 232
Target Start/End: Complemental strand, 24860504 - 24860293
Alignment:
Q  21 agacgctggaagggaagtttgcggatgaggagttcggtgctcttctggtacttacggatctcacggagagcgacggttcctggcctgaaacggtgaggtt 120  Q
    ||||| ||||| |||||||| |||||||| || || ||||| || |||||||| ||||| || || || || |||||||| || | ||||||||||||||    
T  24860504 agacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcggatttcgcgaagtgcaacggttccgggacggaaacggtgaggtt 24860405  T
Q  121 tcttcactccaccggtggccggagcagatttgcgagcggcttttgtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttgctt 220  Q
    |||||||||| |||||||| ||||| ||||| || ||||||||||| || || ||||||||||| ||||| |||||||||||||||||||| ||||||||    
T  24860404 tcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttgcgagctgtttgctt 24860305  T
Q  221 ggtacgtgccat 232  Q
     ||||| |||||    
T  24860304 tgtacgagccat 24860293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 151; Significance: 2e-79; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 151; E-Value: 2e-79
Query Start/End: Original strand, 21 - 478
Target Start/End: Complemental strand, 26592126 - 26591665
Alignment:
Q  21 agacgctggaagggaagtttgcggatgaggagttcggtgctcttctggtacttacggatctcacggagagcgacggttcctggcctgaaacggtgaggtt 120  Q
    ||||||||||| ||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| || |    
T  26592126 agacgctggaaaggaagtttgcgaatgagaagttcggtgctcttctggtacttgcggatctcacggagtgcgacggttcctggcctgaaacggtgtggct 26592027  T
Q  121 tcttcactccaccggtggccggagcagatttgcgagcggcttttgtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttgctt 220  Q
    |||||||||| ||||| |||||||| ||||| |||||||||||||| ||||| ||||||||||| ||||| || |||||||| ||||| || ||||||||    
T  26592026 tcttcactccgccggtcgccggagcggatttccgagcggcttttgttgcgagctgcttccttggtgctttgccgccggtggacttgcgtgcagtttgctt 26591927  T
Q  221 ggtacgtgccatagatgctgaaa---aataactgagaagaacgttttcta--gcagaaaagcttgaaggttgttttggtgatttcagattgagag----- 310  Q
     |||||||||||   ||||||||   ||||||||| || |||  ||||||  | | || || |||    |||||   ||||||| ||||||||||         
T  26591926 agtacgtgccat---tgctgaaagataataactga-aaaaactgtttctactggaaaatagtttg-ttattgttactgtgatttgagattgagagagtga 26591832  T
Q  311 tgatgaagaagaagggatgaaagaggtgagttatataatgatatgattttgtgcgggttttgaaatttgagaagagggtgagtggggtgtgattgtggcc 410  Q
    |||||  |  |||| |||||||| ||||||||||| | ||  |||||||||||  |||||||||||||| ||||||||||| |||| ||||  |||||||    
T  26591831 tgatgtggttgaagagatgaaaggggtgagttataaagtg--atgattttgtgaaggttttgaaatttgtgaagagggtgaatgggttgtgcctgtggcc 26591734  T
Q  411 gttgattattgg-ttaatcgacgggtgtcgtttatttggagtttttgcgacacgcggatcgatgacgtg 478  Q
    |||||||||||| |||||||||||||||||| | ||||||||| ||| ||||  ||||||| |||||||    
T  26591733 gttgattattggtttaatcgacgggtgtcgtgtgtttggagttgttgagacattcggatcggtgacgtg 26591665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 27 - 232
Target Start/End: Original strand, 43479850 - 43480055
Alignment:
Q  27 tggaagggaagtttgcggatgaggagttcggtgctcttctggtacttacggatctcacggagagcgacggttcctggcctgaaacggtgaggtttcttca 126  Q
    ||||| ||||| || | |||||| || ||||| |||||||| ||||| ||||||||||| ||||| || ||||| || | ||| | ||| || |||||||    
T  43479850 tggaatggaagcttcctgatgagaagctcggtactcttctgatacttgcggatctcacgaagagcaacagttccaggacggaatctgtgtggcttcttca 43479949  T
Q  127 ctccaccggtggccggagcagatttgcgagcggcttttgtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttgcttggtacg 226  Q
    |||| |||||||||||||| ||||| ||||||||||| ||||||||||| |||||||||||||| || ||||||||||||||||||||||| ||||||||    
T  43479950 ctcctccggtggccggagctgatttccgagcggctttggtggcgagttgtttccttggagctttgccaccggtggatttgcgagcggtttgtttggtacg 43480049  T
Q  227 tgccat 232  Q
     |||||    
T  43480050 agccat 43480055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 21 - 232
Target Start/End: Complemental strand, 38799453 - 38799242
Alignment:
Q  21 agacgctggaagggaagtttgcggatgaggagttcggtgctcttctggtacttacggatctcacggagagcgacggttcctggcctgaaacggtgaggtt 120  Q
    ||||| ||||| |||||||| |||||||| || || ||||||||||| |||||||||||||| |  | ||| || ||||| || ||||| |  || || |    
T  38799453 agacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaacagttccaggtctgaatctatgtggct 38799354  T
Q  121 tcttcactccaccggtggccggagcagatttgcgagcggcttttgtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttgctt 220  Q
    |||||||||| ||||| |||||||| ||||| |||||||| || |||||||| |||||||  ||||| || || ||||||||||||||||| ||||||||    
T  38799353 tcttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagccttgccgccggtggatttgcgagctgtttgctt 38799254  T
Q  221 ggtacgtgccat 232  Q
    ||||||||||||    
T  38799253 ggtacgtgccat 38799242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 21 - 232
Target Start/End: Original strand, 38822064 - 38822275
Alignment:
Q  21 agacgctggaagggaagtttgcggatgaggagttcggtgctcttctggtacttacggatctcacggagagcgacggttcctggcctgaaacggtgaggtt 120  Q
    ||||| ||||| |||||||| |||||||| || || ||||||||||| |||||||||||||| |  | ||| || ||||| || ||||| |  || || |    
T  38822064 agacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacggatctctctcaaagcaacagttccaggtctgaatctatgtggct 38822163  T
Q  121 tcttcactccaccggtggccggagcagatttgcgagcggcttttgtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttgctt 220  Q
    |||||||||| ||||| |||||||| ||||| |||||||| || |||||||| |||||||  ||||| || || ||||||||||||||||| ||||||||    
T  38822164 tcttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagccttgccgccggtggatttgcgagctgtttgctt 38822263  T
Q  221 ggtacgtgccat 232  Q
    ||||||||||||    
T  38822264 ggtacgtgccat 38822275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 21 - 232
Target Start/End: Complemental strand, 25865658 - 25865447
Alignment:
Q  21 agacgctggaagggaagtttgcggatgaggagttcggtgctcttctggtacttacggatctcacggagagcgacggttcctggcctgaaacggtgaggtt 120  Q
    ||||||||||| ||||| || ||||| |  || || || |||||||| ||||||||||||||||| ||||| |||||||| || |   |||| ||||| |    
T  25865658 agacgctggaatggaagcttacggatcaaaagctcagtactcttctgatacttacggatctcacgaagagcaacggttccaggacgataacgatgaggct 25865559  T
Q  121 tcttcactccaccggtggccggagcagatttgcgagcggcttttgtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttgctt 220  Q
    |||||||||| |||||||  ||||||||||| |  || ||||| || ||||||||||||||||| || || || ||||||||||||||||| ||||||||    
T  25865558 tcttcactccgccggtggttggagcagatttccttgcagctttggtcgcgagttgcttccttggtgccttgccgccggtggatttgcgagcagtttgctt 25865459  T
Q  221 ggtacgtgccat 232  Q
     ||||| |||||    
T  25865458 cgtacgagccat 25865447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 60 - 232
Target Start/End: Complemental strand, 41943863 - 41943691
Alignment:
Q  60 ctcttctggtacttacggatctcacggagagcgacggttcctggcctgaaacggtgaggtttcttcactccaccggtggccggagcagatttgcgagcgg 159  Q
    ||||||||||| |||||||||||||| || || ||||| || || |   | || ||||||||||| ||||||||||| |  ||||||||||||||||| |    
T  41943863 ctcttctggtatttacggatctcacgaagtgcaacggtaccaggacgatagcgatgaggtttcttgactccaccggttgtaggagcagatttgcgagcag 41943764  T
Q  160 cttttgtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttgcttggtacgtgccat 232  Q
    | || ||||| ||||||||||||||||| || || ||||||||||||||||| |||||||| ||||| |||||    
T  41943763 ccttggtggccagttgcttccttggagccttgccaccggtggatttgcgagcagtttgcttagtacgagccat 41943691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 92; Significance: 2e-44; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 45 - 232
Target Start/End: Complemental strand, 13576282 - 13576095
Alignment:
Q  45 atgaggagttcggtgctcttctggtacttacggatctcacggagagcgacggttcctggcctgaaacggtgaggtttcttcactccaccggtggccggag 144  Q
    ||||| || |||||||||||||| ||||| ||||| ||||| |||||||||||||| || | |||||| || || ||||||||||| |||||||||||||    
T  13576282 atgagaagctcggtgctcttctgatacttgcggatttcacgaagagcgacggttccaggacggaaacgatgtggcttcttcactcctccggtggccggag 13576183  T
Q  145 cagatttgcgagcggcttttgtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttgcttggtacgtgccat 232  Q
    | ||||| ||||||||||||||||||||||| || | ||| ||||| || |||||||||||||| || ||||| ||||||||||||||    
T  13576182 cggatttccgagcggcttttgtggcgagttgtttgcgtggtgcttttccgccggtggatttgcgggctgtttgtttggtacgtgccat 13576095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 21 - 232
Target Start/End: Original strand, 34579084 - 34579295
Alignment:
Q  21 agacgctggaagggaagtttgcggatgaggagttcggtgctcttctggtacttacggatctcacggagagcgacggttcctggcctgaaacggtgaggtt 120  Q
    ||||||||||| |||||||| || || |  |||||||| | |||||| |||||||| |||||||| ||||| || ||||| || |   |||| ||||| |    
T  34579084 agacgctggaatggaagtttacgaatcaaaagttcggtacccttctgatacttacgtatctcacgaagagcaactgttccaggacgataacgatgaggct 34579183  T
Q  121 tcttcactccaccggtggccggagcagatttgcgagcggcttttgtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttgctt 220  Q
    |||| | ||| ||||| |  ||  ||||||| ||||| || ||||||||||||||||||||||| || |||||   ||||||| ||||||| ||||||||    
T  34579184 tcttgattccgccggttgttggcacagattttcgagcagcctttgtggcgagttgcttccttggtgccttaccaagggtggatctgcgagcagtttgctt 34579283  T
Q  221 ggtacgtgccat 232  Q
     ||||| |||||    
T  34579284 tgtacgcgccat 34579295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 21 - 232
Target Start/End: Original strand, 34584833 - 34585044
Alignment:
Q  21 agacgctggaagggaagtttgcggatgaggagttcggtgctcttctggtacttacggatctcacggagagcgacggttcctggcctgaaacggtgaggtt 120  Q
    ||||||||||| |||||||| || || |  |||||||| | |||||| |||||||| |||||||| ||||| || ||||| || |   |||| ||||| |    
T  34584833 agacgctggaatggaagtttacgaatcaaaagttcggtacccttctgatacttacgtatctcacgaagagcaactgttccaggacgataacgatgaggct 34584932  T
Q  121 tcttcactccaccggtggccggagcagatttgcgagcggcttttgtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttgctt 220  Q
    |||| | ||| ||||| |  ||  ||||||| ||||| || ||||||||||||||||||||||| || |||||   ||||||| ||||||| ||||||||    
T  34584933 tcttgattccgccggttgttggcacagattttcgagcagcctttgtggcgagttgcttccttggtgccttaccaagggtggatctgcgagcagtttgctt 34585032  T
Q  221 ggtacgtgccat 232  Q
     ||||| |||||    
T  34585033 tgtacgcgccat 34585044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 162 - 232
Target Start/End: Original strand, 34571787 - 34571857
Alignment:
Q  162 tttgtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttgcttggtacgtgccat 232  Q
    ||||||||||||| ||||||||| || || || ||||||||||||||||| |||||||| ||||| |||||    
T  34571787 tttgtggcgagttccttccttggtgccttgccaccggtggatttgcgagcagtttgctttgtacgcgccat 34571857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 21 - 100
Target Start/End: Original strand, 34571616 - 34571695
Alignment:
Q  21 agacgctggaagggaagtttgcggatgaggagttcggtgctcttctggtacttacggatctcacggagagcgacggttcc 100  Q
    ||||||||||| |||||||| ||||| |  |||||||| |||||||| |||||||| |||||||| ||||| || |||||    
T  34571616 agacgctggaatggaagtttacggatcaaaagttcggtactcttctgatacttacgtatctcacgaagagcaactgttcc 34571695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 79; Significance: 1e-36; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 54 - 232
Target Start/End: Complemental strand, 12531417 - 12531239
Alignment:
Q  54 tcggtgctcttctggtacttacggatctcacggagagcgacggttcctggcctgaaacggtgaggtttcttcactccaccggtggccggagcagatttgc 153  Q
    |||||||||||||||||||| ||||||||||| || || || |||||||| | ||| | ||| || ||||| ||||| ||||| |||||||||||||| |    
T  12531417 tcggtgctcttctggtacttgcggatctcacgaagtgcaacagttcctggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttcc 12531318  T
Q  154 gagcggcttttgtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttgcttggtacgtgccat 232  Q
    | || ||||| ||||| || ||||||||||| ||||| || ||||||||||||||||| |||||||||||||| |||||    
T  12531317 gggcagctttagtggcaagctgcttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccat 12531239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 54 - 232
Target Start/End: Original strand, 12547202 - 12547380
Alignment:
Q  54 tcggtgctcttctggtacttacggatctcacggagagcgacggttcctggcctgaaacggtgaggtttcttcactccaccggtggccggagcagatttgc 153  Q
    |||||||||||||||||||| ||||||||||| || || || |||||||| | ||| | ||| || ||||| ||||| ||||| |||||||||||||| |    
T  12547202 tcggtgctcttctggtacttgcggatctcacgaagtgcaacagttcctggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttcc 12547301  T
Q  154 gagcggcttttgtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttgcttggtacgtgccat 232  Q
    | || ||||| ||||| || ||||||||||| ||||| || ||||||||||||||||| |||||||||||||| |||||    
T  12547302 gggcagctttagtggcaagctgcttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccat 12547380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 71 - 231
Target Start/End: Original strand, 9866878 - 9867038
Alignment:
Q  71 cttacggatctcacggagagcgacggttcctggcctgaaacggtgaggtttcttcactccaccggtggccggagcagatttgcgagcggcttttgtggcg 170  Q
    ||||||||||||||| || || |||||||| || | ||||||||| || ||||||||||| || || |||||||| ||||| ||||| |||||||||||     
T  9866878 cttacggatctcacgaagcgcaacggttccaggacggaaacggtgtggcttcttcactcctcccgttgccggagctgatttccgagcagcttttgtggcc 9866977  T
Q  171 agttgcttccttggagctttacctccggtggatttgcgagcggtttgcttggtacgtgcca 231  Q
    || | ||| | ||| |||||||| ||||||||||||||||| ||||| ||||||| |||||    
T  9866978 agcttctttcatggtgctttaccgccggtggatttgcgagccgtttgtttggtacatgcca 9867038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 57 - 151
Target Start/End: Complemental strand, 9869937 - 9869843
Alignment:
Q  57 gtgctcttctggtacttacggatctcacggagagcgacggttcctggcctgaaacggtgaggtttcttcactccaccggtggccggagcagattt 151  Q
    ||||||||||||||||||||||||||||| ||||| ||||||||  | | ||||| ||| |||||||||||| | ||||| ||| |||| |||||    
T  9869937 gtgctcttctggtacttacggatctcacgaagagcaacggttccatgacagaaacagtgtggtttcttcactgccccggttgccagagctgattt 9869843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0197 (Bit Score: 76; Significance: 9e-35; HSPs: 1)
Name: scaffold0197
Description:

Target: scaffold0197; HSP #1
Raw Score: 76; E-Value: 9e-35
Query Start/End: Original strand, 57 - 232
Target Start/End: Complemental strand, 30934 - 30759
Alignment:
Q  57 gtgctcttctggtacttacggatctcacggagagcgacggttcctggcctgaaacggtgaggtttcttcactccaccggtggccggagcagatttgcgag 156  Q
    ||||||||||||||||| ||||| ||||| || || |||||||| || | ||||||||| || ||||||||||| ||||| |||||||| ||||| || |    
T  30934 gtgctcttctggtacttgcggatttcacgaagcgccacggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtg 30835  T
Q  157 cggcttttgtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttgcttggtacgtgccat 232  Q
    ||||||| ||||||||||| || | ||| ||||| || |||||||||||||| || ||||| ||||||||||||||    
T  30834 cggctttggtggcgagttgtttgcgtggggcttttccgccggtggatttgcgtgctgtttgtttggtacgtgccat 30759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 76; Significance: 9e-35; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 76; E-Value: 9e-35
Query Start/End: Original strand, 57 - 232
Target Start/End: Complemental strand, 21317496 - 21317321
Alignment:
Q  57 gtgctcttctggtacttacggatctcacggagagcgacggttcctggcctgaaacggtgaggtttcttcactccaccggtggccggagcagatttgcgag 156  Q
    ||||||||||||||||| ||||| ||||| || || |||||||| || | ||||||||| || ||||||||||| ||||| |||||||| ||||| || |    
T  21317496 gtgctcttctggtacttgcggatttcacgaagcgccacggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtg 21317397  T
Q  157 cggcttttgtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttgcttggtacgtgccat 232  Q
    ||||||| ||||||||||| || | ||| ||||| || |||||||||||||| || ||||| ||||||||||||||    
T  21317396 cggctttggtggcgagttgtttgcgtggggcttttccgccggtggatttgcgtgctgtttgtttggtacgtgccat 21317321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 27 - 232
Target Start/End: Original strand, 3930137 - 3930342
Alignment:
Q  27 tggaagggaagtttgcggatgaggagttcggtgctcttctggtacttacggatctcacggagagcgacggttcctggcctgaaacggtgaggtttcttca 126  Q
    ||||| |||||||| |  ||||| ||||| ||||||||||| ||||| ||||||||||| || ||||| |||||||| | ||| | ||| |||||||| |    
T  3930137 tggaatggaagtttcctaatgagaagttcagtgctcttctgatacttgcggatctcacgaagtgcgactgttcctggacggaatctgtgtggtttcttta 3930236  T
Q  127 ctccaccggtggccggagcagatttgcgagcggcttttgtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttgcttggtacg 226  Q
    | |||||||| ||||| || ||||| |  |||||||| ||||||||||| |||| ||| ||||| |||||||||||||| || || ||||| ||||||||    
T  3930237 caccaccggttgccggtgctgattttcttgcggctttggtggcgagttgtttccgtggggcttttcctccggtggattttcgtgctgtttgtttggtacg 3930336  T
Q  227 tgccat 232  Q
    ||||||    
T  3930337 tgccat 3930342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 165 - 232
Target Start/End: Original strand, 7594910 - 7594977
Alignment:
Q  165 gtggcgagttgcttccttggagctttacctccggtggatttgcgagcggtttgcttggtacgtgccat 232  Q
    |||||||| |||||||||||||| ||||| ||||| || ||||||||||||||||||||||| |||||    
T  7594910 gtggcgagctgcttccttggagccttaccaccggtagacttgcgagcggtttgcttggtacgagccat 7594977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University