View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16994_low_13 (Length: 268)

Name: NF16994_low_13
Description: NF16994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16994_low_13
NF16994_low_13
[»] chr1 (1 HSPs)
chr1 (66-259)||(2512089-2512284)


Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 66 - 259
Target Start/End: Original strand, 2512089 - 2512284
Alignment:
Q  66 aaattttcaccctcatggagcataaaagagatattgacaactataaaagttcaactaatcacctgccacattgtaataatagccaagatgggaataaatt 165  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2512089 aaattttcaccctcatagagcataaaagagatattgacaactataaaagttcaactaatcacctgccacattgtaataatagccaagatgggaataaatt 2512188  T
Q  166 aaaaagtatttctt-nnnnnnnnngactagagtaattgttaaaaactaaaagcaaccaagtaaaagctatcaacc---tatttaagagtacagaataa 259  Q
      ||||||||||||          |||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||| |||||    
T  2512189 --aaagtatttcttaaacaaaaaagactagagtaattgttaaaaactaaaagcaaccaagtaaaagctatcaacctattatttaagagtacaaaataa 2512284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University