View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16991_low_55 (Length: 250)

Name: NF16991_low_55
Description: NF16991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16991_low_55
NF16991_low_55
[»] chr7 (1 HSPs)
chr7 (21-181)||(42858080-42858241)


Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 21 - 181
Target Start/End: Original strand, 42858080 - 42858241
Alignment:
Q  21 tcaaactgttaatctgattgaaagtttgaaacattgctgactcgagcatgatagaattcattctatcggataatgtcaaaattgtctctaacaaatagtc 120  Q
    ||||||||||||||||||||| ||||||| ||||| ||| ||  ||||||||||||||||||| |||  |||||||||||||||||||||||||||||||    
T  42858080 tcaaactgttaatctgattgagagtttgagacattactggctgtagcatgatagaattcattccatcacataatgtcaaaattgtctctaacaaatagtc 42858179  T
Q  121 attaatttcaggcaaagtattctatgttgagtgtc-actaatatatcatccacttggagtgt 181  Q
    |||||||||||||||||||||||||||||||||||  ||||||||||||||||||| |||||    
T  42858180 attaatttcaggcaaagtattctatgttgagtgtctgctaatatatcatccacttgaagtgt 42858241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University