View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1698_low_43 (Length: 223)

Name: NF1698_low_43
Description: NF1698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1698_low_43
NF1698_low_43
[»] chr7 (1 HSPs)
chr7 (10-202)||(33494842-33495034)


Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 10 - 202
Target Start/End: Original strand, 33494842 - 33495034
Alignment:
Q  10 aagaaaataaaactagttttagcaattcaactaagtttatgcttgaataaaaaatcatttaaatttttataagagcaccatatagcgtcaaaagttgctt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  33494842 aagaaaataaaactagttttagcaattcaactaagtttatgcttggataaaaaatcatttaaatttttatatgagcaccatatagcgtcaaaagttgctt 33494941  T
Q  110 tcccatcataagctcaaaatacagataaaacaaaatcgctaatgtgaatgtcataacttatgatcatccatgtacaaagaatagcagtccata 202  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  33494942 tcccatcataagctcaaaatacagataaaacaaaatcactaatgtgaatgtcataacttatgatcatccatgtacaaagaatagtagtccata 33495034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University