View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1698_high_15 (Length: 314)

Name: NF1698_high_15
Description: NF1698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1698_high_15
NF1698_high_15
[»] chr8 (1 HSPs)
chr8 (17-217)||(44023827-44024027)


Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 17 - 217
Target Start/End: Complemental strand, 44024027 - 44023827
Alignment:
Q  17 tcccggaagcactcgttaacaagactcttgatattatatcatcacttgcaagtaaatatctcatacattgcaatgatatggtcttatttagagaatcaaa 116  Q
    |||||| |||| |||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  44024027 tcccgggagcattcgttaacaaaactcttaatattatatcatcacttgcaagtaaatatctcatacattgcaatgatatagtcttatttagagaatcaaa 44023928  T
Q  117 agaaaaattgaattggaggtcggagattcaaagacaagtcttagatcgaatagcttgaataaaagcaagtatgtaaaatgtaaacgagtcctagtaaata 216  Q
    |||||||||| ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44023927 agaaaaattggattggaggttggagattcaaagacaagtcttaaatcgaatagcttgaataaaagcaagtatgtaaaatgtaaacgagtcctagtaaata 44023828  T
Q  217 a 217  Q
    |    
T  44023827 a 44023827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University