View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16984_low_13 (Length: 268)

Name: NF16984_low_13
Description: NF16984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16984_low_13
NF16984_low_13
[»] chr4 (2 HSPs)
chr4 (139-251)||(54080472-54080584)
chr4 (20-106)||(54080620-54080706)


Alignment Details
Target: chr4 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 139 - 251
Target Start/End: Complemental strand, 54080584 - 54080472
Alignment:
Q  139 ctgatcctttgcgtgaacagctcatctcatggttataggtgaggtagggattttgtctgtgcaccagaaagtctactttttgttttgccaatagtggtgg 238  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54080584 ctgatcctttgcgtggacagctcatctcatggttataggtgaggtagggattttgtctgtgcaccagaaagtctactttttgttttgccaatagtggtgg 54080485  T
Q  239 tgccactgtcagt 251  Q
    |||||||||||||    
T  54080484 tgccactgtcagt 54080472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 20 - 106
Target Start/End: Complemental strand, 54080706 - 54080620
Alignment:
Q  20 catatgatggccactaaccatagtggaggatgaaaggctgtttattattgactatatgcatgataatatgacatggtgtttttgctc 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54080706 catatgatggccactaaccatagtggaggatgaaaggctgtttattattgactatatgcatgataatatgacatggtgtttttgctc 54080620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University