View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16983_high_4 (Length: 392)

Name: NF16983_high_4
Description: NF16983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16983_high_4
NF16983_high_4
[»] chr2 (1 HSPs)
chr2 (112-236)||(7307890-7308014)
[»] chr6 (2 HSPs)
chr6 (201-250)||(13245530-13245579)
chr6 (340-378)||(13245400-13245438)


Alignment Details
Target: chr2 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 112 - 236
Target Start/End: Complemental strand, 7308014 - 7307890
Alignment:
Q  112 atcaatcttttattatggaaatggtgattgagtaattcgaagttgtcatgttgcctctattatgaatagtgttaggatcctcgtatgtgtatggtaagtt 211  Q
    ||||| |||||||| | |||||||||||||||||| |||||||||||   |||||||| |||||||| ||||| ||||||| |||||||||||||  |||    
T  7308014 atcaagcttttattgtagaaatggtgattgagtaaatcgaagttgtctcattgcctctgttatgaatggtgttgggatccttgtatgtgtatggttggtt 7307915  T
Q  212 gagattacggtttttggttggattt 236  Q
    |||||| |||||||||||| |||||    
T  7307914 gagattgcggtttttggtttgattt 7307890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 13245579 - 13245530
Alignment:
Q  201 tatggtaagttgagattacggtttttggttggatttagctggtttttgag 250  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||    
T  13245579 tatggtaagttgagattacggtttttggttcgatttagctggtttttgag 13245530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 378
Target Start/End: Complemental strand, 13245438 - 13245400
Alignment:
Q  340 ccatccctgtatttgtggggttagtcttaattccctatg 378  Q
    |||||||||| ||||||||||||||||||||||||||||    
T  13245438 ccatccctgtgtttgtggggttagtcttaattccctatg 13245400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University