View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16981_low_9 (Length: 218)

Name: NF16981_low_9
Description: NF16981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16981_low_9
NF16981_low_9
[»] chr1 (1 HSPs)
chr1 (19-190)||(49587485-49587656)


Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 49587656 - 49587485
Alignment:
Q  19 taacatgaccaagagaaggctaaatatgacgcatgagagagatagggggcagcaaggagttatgtcgcatcaataatgattacaagtatgagtaaacaaa 118  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49587656 taacatgaccaagagaaggctaaatatgacgcatgatagagatagggggcagcaaggagttatgtcgcatcaataatgattacaagtatgagtaaacaaa 49587557  T
Q  119 gcatccaagctaagccgtggactgtggacagacacaacacataatccctcaacgtcaataagcaacttgaca 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49587556 gcatccaagctaagccgtggactgtggacagacacaacacataatccctcaacgtcaataagcaacttgaca 49587485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University