View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16976_low_19 (Length: 380)

Name: NF16976_low_19
Description: NF16976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16976_low_19
NF16976_low_19
[»] chr2 (3 HSPs)
chr2 (61-147)||(7352841-7352923)
chr2 (102-134)||(7332107-7332139)
chr2 (112-147)||(7291095-7291131)


Alignment Details
Target: chr2 (Bit Score: 50; Significance: 2e-19; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 61 - 147
Target Start/End: Complemental strand, 7352923 - 7352841
Alignment:
Q  61 attttgatgctattttttgtgtttaattagaaatcacagatagtttcttactcaaatggttgtaaatgaatggattacttagttgaa 147  Q
    |||||||||||||| |||||||| |    ||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||||    
T  7352923 attttgatgctattgtttgtgttca----gaaatcagagattgtttcttactcaaatggttgtaaatgaatggattagttagttgaa 7352841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 102 - 134
Target Start/End: Complemental strand, 7332139 - 7332107
Alignment:
Q  102 agtttcttactcaaatggttgtaaatgaatgga 134  Q
    |||||||||||||||||||||||||||||||||    
T  7332139 agtttcttactcaaatggttgtaaatgaatgga 7332107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 112 - 147
Target Start/End: Complemental strand, 7291131 - 7291095
Alignment:
Q  112 tcaaatggtt-gtaaatgaatggattacttagttgaa 147  Q
    |||||||||| ||||||||||||||||||||||||||    
T  7291131 tcaaatggtttgtaaatgaatggattacttagttgaa 7291095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University