View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16976_high_37 (Length: 249)

Name: NF16976_high_37
Description: NF16976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16976_high_37
NF16976_high_37
[»] chr5 (1 HSPs)
chr5 (1-249)||(243741-243989)
[»] chr3 (2 HSPs)
chr3 (75-130)||(21206127-21206182)
chr3 (1-38)||(21210518-21210555)


Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 243741 - 243989
Alignment:
Q  1 tgcagggagagatgaagttgatatgcttgagattgctggcttgattagccctcacttccttaattgaaggcaaggtttagtttttatatcaaggccacat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  243741 tgcagggagagatgaagttgatatgcttgagattgctggcttgattagccctcacttccttaattgaaggcaaggtttagtttttatatcaaggccacat 243840  T
Q  101 tttggtgtatggaactgttatatttggaagtatgtgtcctgcaactgcaacatagtagtagccttagnnnnnnnnnnnngttagtactttgggtacagaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            |||||||||||||||||||||    
T  243841 tttggtgtatggaactgttatatttggaagtatgtgtcctgcaactgcaacatagtagtagccttagttttttgtttttgttagtactttgggtacagaa 243940  T
Q  201 caagattctgttgaagatttcgttttgaatcatgtatattcttcgacat 249  Q
    ||||||||||||||||||||||||||||||||||||  |||||| ||||    
T  243941 caagattctgttgaagatttcgttttgaatcatgtaatttcttcaacat 243989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 75 - 130
Target Start/End: Complemental strand, 21206182 - 21206127
Alignment:
Q  75 gtttagtttttatatcaaggccacattttggtgtatggaactgttatatttggaag 130  Q
    ||||||||||||||| |||||||||||||||||||||||||| |||||||||||||    
T  21206182 gtttagtttttatatgaaggccacattttggtgtatggaactattatatttggaag 21206127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 21210555 - 21210518
Alignment:
Q  1 tgcagggagagatgaagttgatatgcttgagattgctg 38  Q
    |||||||||||||||| ||| |||||||||||||||||    
T  21210555 tgcagggagagatgaatttggtatgcttgagattgctg 21210518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University