View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16975_low_65 (Length: 230)

Name: NF16975_low_65
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16975_low_65
NF16975_low_65
[»] chr1 (1 HSPs)
chr1 (1-201)||(39790565-39790768)


Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 39790565 - 39790768
Alignment:
Q  1 tctccgcatgaaaatatctttgactaatttggctatcattagtagtttttcgatgaataaattggactgtaataaaaattgtgacaggcaaaattgagtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  39790565 tctccgcatgaaaatatctttgactaatttggctatcattagtagtttttcgatgaataaattggaccgtaataaaaattgtgacaggcaaaattgagtt 39790664  T
Q  101 ttta---taaaaataaatttgttattaattgatagtaacatagtattatgaagcactgtcatgcatgcagctgcaaatctcacatgtccggtttttaatt 197  Q
    ||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39790665 tttagtctaaaaataaatttgttattaattgatagtaacatagtattatgaagcactgtcatgcatgcagctgcaaatctcacatgtccggtttttaatt 39790764  T
Q  198 atta 201  Q
    ||||    
T  39790765 atta 39790768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University