View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16975_low_24 (Length: 357)

Name: NF16975_low_24
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16975_low_24
NF16975_low_24
[»] chr8 (2 HSPs)
chr8 (20-127)||(2095474-2095581)
chr8 (256-344)||(2095221-2095309)


Alignment Details
Target: chr8 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 20 - 127
Target Start/End: Complemental strand, 2095581 - 2095474
Alignment:
Q  20 taactagaagaatatgaagaacaaagaaaggttggtggaagagtggctagaagaagtttaaatcctgtcttgaaagaagttaaaaagcaaggtgtccggc 119  Q
    ||||||||||| | | |||||||||||| ||||||||||||||||||||||||||||| |  |||||||||| |||| ||||||||||||||||||||||    
T  2095581 taactagaagatttttaagaacaaagaagggttggtggaagagtggctagaagaagttcatgtcctgtcttggaagaggttaaaaagcaaggtgtccggc 2095482  T
Q  120 tacgactt 127  Q
    | ||||||    
T  2095481 ttcgactt 2095474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 256 - 344
Target Start/End: Complemental strand, 2095309 - 2095221
Alignment:
Q  256 tggtttccttttgatgatattatggatttttcgtgccttggggaacaaattgcataatattatcaaattttaggtctaactgtttaagc 344  Q
    ||||||| ||||| |||  ||||||||| ||  || ||||||||||||||||||||||||||||| |||| |||||||| |||||||||    
T  2095309 tggtttctttttgttgaatttatggattattgatgacttggggaacaaattgcataatattatcagatttgaggtctaattgtttaagc 2095221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University