View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16975_high_70 (Length: 211)

Name: NF16975_high_70
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16975_high_70
NF16975_high_70
[»] chr4 (1 HSPs)
chr4 (14-195)||(40006227-40006407)


Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 14 - 195
Target Start/End: Original strand, 40006227 - 40006407
Alignment:
Q  14 ataatactgtttttcactttaaaaagtgatgtctaaactgataacagtgtacgaatagcgcttnnnnnnnnntatttaaggccnnnnnnntgtgttatct 113  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||         |||||||||||       ||||||||||    
T  40006227 ataacactgtttttcactttaaaaagtgatgtctaaactgataacagtgtaggaatagcgcttaaaaaaaa-tatttaaggccaaaaaaatgtgttatct 40006325  T
Q  114 aaggtcatttttggcgtagtgagggaaatgaagattagattggttaagtggtttgggagagagatgtgaggacagtcaactt 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40006326 aaggtcatttttggcgtagtgagggaaatgaagattagattggttaagtggtttgggagagagatgtgaggacagtcaactt 40006407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University