View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16975_high_56 (Length: 236)

Name: NF16975_high_56
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16975_high_56
NF16975_high_56
[»] chr7 (1 HSPs)
chr7 (1-219)||(32861584-32861787)


Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 32861584 - 32861787
Alignment:
Q  1 tattgatcatatgttgaaaaacaaagctgtgcatggtaccatggttttaaattgtggttgcgtatgcggttgcggttgcggacacaacgattgtggacat 100  Q
    |||||||||||||||||||||||||  ||||||||||||||||||||||||||||||| |||||||||      ||||||||||||||||||||||||||    
T  32861584 tattgatcatatgttgaaaaacaaacttgtgcatggtaccatggttttaaattgtggtcgcgtatgcg------gttgcggacacaacgattgtggacat 32861677  T
Q  101 tgcagttgttgcgatgcttattgcagtcattgcagcgtggacacgacactgatattgacatattgactggtaaaaatttaagaaaatgaacgtaatcaca 200  Q
    |||||||||||| ||||||||||||||| |||||||||||||||||| |||        ||||||| |||||||||||||||||||||||||||||||||    
T  32861678 tgcagttgttgcaatgcttattgcagtcgttgcagcgtggacacgac-ctg--------atattgagtggtaaaaatttaagaaaatgaacgtaatcaca 32861768  T
Q  201 tgtgttgttgtcggatatt 219  Q
    |||||||||||||||||||    
T  32861769 tgtgttgttgtcggatatt 32861787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University