View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16974_low_51 (Length: 244)

Name: NF16974_low_51
Description: NF16974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16974_low_51
NF16974_low_51
[»] chr2 (1 HSPs)
chr2 (13-130)||(192375-192493)


Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 13 - 130
Target Start/End: Original strand, 192375 - 192493
Alignment:
Q  13 aatattgaacaaaactcgatataaatttcaaaa-aatagaaacctagatatttctcattttcacaattttggttgtgattgttgcattttagactacaaa 111  Q
    |||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  192375 aatattgaacaaaactcgatataaatttaaaaaaaatagaaacctagatatttctcattttcacaattttggttgtgattgttgcattttagacgacaaa 192474  T
Q  112 taaagcatgcatgtcattt 130  Q
    |||||||||||||||||||    
T  192475 taaagcatgcatgtcattt 192493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University