View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16974_high_46 (Length: 232)

Name: NF16974_high_46
Description: NF16974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16974_high_46
NF16974_high_46
[»] chr4 (1 HSPs)
chr4 (128-219)||(56230468-56230559)
[»] chr7 (1 HSPs)
chr7 (139-219)||(39188286-39188366)


Alignment Details
Target: chr4 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 128 - 219
Target Start/End: Complemental strand, 56230559 - 56230468
Alignment:
Q  128 taaaagagtggacctgttgcaacggaagcctgtgtgatcactctgacaagttcctttccaccttgagggaatgggccctatcccttcatctc 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  56230559 taaaagagtggacctgttgcaacggaagcctgtgtgatcactctgacaagttcctttccaccttgagggaatgggccctatcccttcatctc 56230468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 139 - 219
Target Start/End: Complemental strand, 39188366 - 39188286
Alignment:
Q  139 acctgttgcaacggaagcctgtgtgatcactctgacaagttcctttccaccttgagggaatgggccctatcccttcatctc 219  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39188366 acctgttgcaacggaagcctgtgtgatcattctgacaagttcctttccaccttgagggaatgggccctatcccttcatctc 39188286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University