View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16974_high_29 (Length: 351)

Name: NF16974_high_29
Description: NF16974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16974_high_29
NF16974_high_29
[»] chr5 (2 HSPs)
chr5 (166-320)||(33112809-33112963)
chr5 (12-59)||(33112650-33112697)
[»] chr2 (1 HSPs)
chr2 (183-241)||(21562499-21562557)


Alignment Details
Target: chr5 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 166 - 320
Target Start/End: Original strand, 33112809 - 33112963
Alignment:
Q  166 ttacttgttttgtaacatgcaggtgtcatatctggggctcttttgtacatcagagatgatttcaaagctgttgataccaaagtttggcttaaggtaaatt 265  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  33112809 ttacttgttttgtaacatgcaggtgtcatatctggggctcttttgtacatcagagatgatttcaaagctgttgataccaaagtttggcttcaggtaaatt 33112908  T
Q  266 tctttcatatgatatcaatgtgtattctttatatgtgttttaatttaatttctat 320  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  33112909 tctttcatatgatatgaatgtgtattctttatatgtgttttaatttaatttctat 33112963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 12 - 59
Target Start/End: Original strand, 33112650 - 33112697
Alignment:
Q  12 ttcctatgtttcaatctctcatgttatcaaccattagtctatttaaca 59  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
T  33112650 ttcctatgtttcaatctctcatgttatcaaccattagtctatttaaca 33112697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 183 - 241
Target Start/End: Complemental strand, 21562557 - 21562499
Alignment:
Q  183 tgcaggtgtcatatctggggctcttttgtacatcagagatgatttcaaagctgttgata 241  Q
    |||||| ||||||||||||||||||||||| || ||||||||||| || ||||| ||||    
T  21562557 tgcaggagtcatatctggggctcttttgtatataagagatgattttaaggctgtggata 21562499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University