View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1696_low_58 (Length: 212)

Name: NF1696_low_58
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1696_low_58
NF1696_low_58
[»] chr7 (2 HSPs)
chr7 (114-197)||(45642076-45642159)
chr7 (1-51)||(45642222-45642272)


Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 114 - 197
Target Start/End: Complemental strand, 45642159 - 45642076
Alignment:
Q  114 gccataccaatctatgacccaagtatacaatccagaatgcaaattttgtttctaagttctctacagctttccaaatatatgaag 197  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45642159 gccataccaatctatgagccaagtatacaatccagaatgcaaattttgtttctaagttctctacagctttccaaatatatgaag 45642076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 45642272 - 45642222
Alignment:
Q  1 gaatactgattgcatagttattatcattggaaccctttaatgtcatcagtc 51  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45642272 gaatactgattgcatagttattatcattggaaccctttaatgtcatcagtc 45642222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University