View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1696_low_34 (Length: 266)

Name: NF1696_low_34
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1696_low_34
NF1696_low_34
[»] chr6 (1 HSPs)
chr6 (9-249)||(24637685-24637924)


Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 9 - 249
Target Start/End: Original strand, 24637685 - 24637924
Alignment:
Q  9 gattattcttcaagattaagggaagaggatgaggagttcaaaagagaccaaacaaataaatcgtaatgtcccatattatattggtaaaaagattgacaaa 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24637685 gattattcttcaagattaagggaagaggatgaggagttcaaaagagaccaaacaaataaatcgtaatgtcccatattatattggtaaaaagattgacaaa 24637784  T
Q  109 aaggttagcctctatatagatagatgtgcaagatacggagctcccaatcacgagataaaagagtcagctggttggtgaagcagcgttagtattgaaatgc 208  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| ||||||||||||||||||||||||||||||||    
T  24637785 aaagttagcctctatatagatagatgtgcaagatacggagctcccaatcacgatat-aaagagtcagttggttggtgaagcagcgttagtattgaaatgc 24637883  T
Q  209 agggttggaagtctcccttttttatacctggggctgcctat 249  Q
    |  |||||||||||||||||| | ||  |||||||||||||    
T  24637884 aatgttggaagtctcccttttgtgtatttggggctgcctat 24637924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University