View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16969_high_6 (Length: 310)

Name: NF16969_high_6
Description: NF16969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16969_high_6
NF16969_high_6
[»] chr8 (1 HSPs)
chr8 (118-291)||(419382-419555)


Alignment Details
Target: chr8 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 118 - 291
Target Start/End: Original strand, 419382 - 419555
Alignment:
Q  118 ctggaatgcatgctactagttaatagctacacattgcttgagtacgttcactacccggtggagaaaaacattgagcttgaagttgttgaagggcttgggg 217  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  419382 ctggaatgcatgctactagttaatagctacacattgctcgagtacgttcactacccggtggagaaaaacattgagcttgaagttgttgaagggcttgggg 419481  T
Q  218 tttggtacgacctttgtcgaaaataatccggtggagatacggccacagtcacagaagatgtagattgagttcca 291  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  419482 tttggtacgacctttgtcgaaaataatccggtggagatacggccacagtcacagaagatgtggattgagttcca 419555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University