View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16967_high_37 (Length: 239)

Name: NF16967_high_37
Description: NF16967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16967_high_37
NF16967_high_37
[»] chr4 (1 HSPs)
chr4 (31-107)||(51275271-51275347)


Alignment Details
Target: chr4 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 31 - 107
Target Start/End: Complemental strand, 51275347 - 51275271
Alignment:
Q  31 tatgcatgattagttccaaactaataatagttattctatactataaattgatagctaataatgcattctacaaatgt 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51275347 tatgcatgattagttccaaactaataatagttattctatactataaattgatagctaataatgcattctacaaatgt 51275271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University