View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16964_high_5 (Length: 379)

Name: NF16964_high_5
Description: NF16964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16964_high_5
NF16964_high_5
[»] chr7 (2 HSPs)
chr7 (256-374)||(5596109-5596227)
chr7 (110-212)||(5596271-5596378)


Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 256 - 374
Target Start/End: Complemental strand, 5596227 - 5596109
Alignment:
Q  256 tttcattgattttaaatacccaaaacctttctcttttccctcctttctgttgaatttaaatacccttttgttgattcttgatcaatcaagcaaaaagttc 355  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5596227 tttcattgattttaaatacccaaaacctctctcttttccctcctttctgttgaatttaaatacccttttgttgattcttgatcaatcaagcaaaaagttc 5596128  T
Q  356 cctcctttttgttgatttt 374  Q
    |||||||||||||||||||    
T  5596127 cctcctttttgttgatttt 5596109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 110 - 212
Target Start/End: Complemental strand, 5596378 - 5596271
Alignment:
Q  110 ttcaaaccatgaaaactttact----aaaccagggtacaaggaaccggg-aacttcactagggcatagggaagcgggaacctgaaagtaaacgatcttat 204  Q
    ||||||||||||||||||||||    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || ||||||||||    
T  5596378 ttcaaaccatgaaaactttacttactaaaccagggtacaaggaaccggggaacttcactagggcatagggaagcgggaacctgaaaatatacgatcttat 5596279  T
Q  205 ccgattat 212  Q
    ||||||||    
T  5596278 ccgattat 5596271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University