View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16962_high_6 (Length: 269)

Name: NF16962_high_6
Description: NF16962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16962_high_6
NF16962_high_6
[»] chr1 (1 HSPs)
chr1 (70-249)||(38584185-38584364)


Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 70 - 249
Target Start/End: Original strand, 38584185 - 38584364
Alignment:
Q  70 cctcaacaagtacttgatatggcaatgaaataatagtcaataaattttcttccctactatttttgggatgatgttgtgagataatattggtgattgtttg 169  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38584185 cctcaacaagtacttgatatggcaatgaaataatagtcaataaattttcttccctactatttttgggatgatgttgtgagataatattggtgattgtttg 38584284  T
Q  170 gttcaagatttaaattataggtatgcattgacccatggcttctatgaaccgttgaggaaattcattggccatgtatatag 249  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38584285 gttcaagatttaaattataggtatgcattgacccatggcttctatgaaccgttgaggaaattcattggccatgtatatag 38584364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University