View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16958_high_26 (Length: 213)

Name: NF16958_high_26
Description: NF16958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16958_high_26
NF16958_high_26
[»] chr4 (1 HSPs)
chr4 (49-101)||(51101177-51101229)


Alignment Details
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 49 - 101
Target Start/End: Original strand, 51101177 - 51101229
Alignment:
Q  49 agacaacggtttaagaaattaaatagcaacagtttctgattttctaaaacacg 101  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51101177 agacaacggtttaagaaattaaatagcaacagtttctgattttctaaaacacg 51101229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University