View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16956_high_24 (Length: 241)

Name: NF16956_high_24
Description: NF16956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16956_high_24
NF16956_high_24
[»] chr3 (1 HSPs)
chr3 (9-164)||(32496961-32497117)


Alignment Details
Target: chr3 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 9 - 164
Target Start/End: Original strand, 32496961 - 32497117
Alignment:
Q  9 gagatgaattgaatgagaagtggctctgcagttggagaaagtagtggagttcattgttgttcgtcacgcaacaacgttgttgttacggagagaagtagaa 108  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  32496961 gagaggaattgaatgagaagtggctctgcagttggagaaagtagtggagttcattgttgttcgacacgcaacaacgttgttgttacggagagaagtagaa 32497060  T
Q  109 gatgatgatg-ttttttgctgcggttttggtttcactctatgtttgtgttttcataa 164  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  32497061 gatgatgatgtttttttgctgcggttttggtttcactctatgtttgtgttttcataa 32497117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University