View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16954_low_11 (Length: 242)

Name: NF16954_low_11
Description: NF16954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16954_low_11
NF16954_low_11
[»] chr1 (1 HSPs)
chr1 (1-232)||(33718714-33718957)


Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 33718714 - 33718957
Alignment:
Q  1 taaaagatgctagccttgaaagtaattatcacaagcaacaaattgcttgatattggttagtcaatagttagacccagt------------gcgataaata 88  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |||||            ||||||||||    
T  33718714 taaaagatgctagccttgaaagtaattatcacaagcaacaaattgcttgacattgattagtcaatagttagagccagttagttagagtctgcgataaata 33718813  T
Q  89 acaggatagaaataacagacgacaaagaaacgagatgattcttggaccttgaagaggagattgggagggaaagcctaggtctttcaaatacttggagtag 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33718814 acaggatagaaataacagacgacaaagaaacgagatgattcttggaccttgaagaggagattgggagggaaagcctaggtctttcaaatacttggagtag 33718913  T
Q  189 ggactacatttaaggggttgatatctcaacatatgttttttcat 232  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
T  33718914 ggactacatttaaggggttgatatctcaacatatgttttttcat 33718957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University