View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16944_high_11 (Length: 283)

Name: NF16944_high_11
Description: NF16944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16944_high_11
NF16944_high_11
[»] chr4 (5 HSPs)
chr4 (14-269)||(26954173-26954427)
chr4 (35-168)||(26975976-26976109)
chr4 (35-168)||(27005797-27005930)
chr4 (116-168)||(26946474-26946526)
chr4 (104-168)||(26991351-26991415)


Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 14 - 269
Target Start/End: Complemental strand, 26954427 - 26954173
Alignment:
Q  14 gaactagccgagaagagtgtgtggaatcaaatgaaggaaattgtgaagtttacaggaccagctatgggattatggttatgtgatccactcatgagcctca 113  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26954427 gaactagcagagaagagtgtgtggaatcaaatgaaggaaattgtgaagtttacaggaccagctatgggattatggttatgtgatccactcatgagcctca 26954328  T
Q  114 tagatactgctgttgttggtcagggaagttcaaccgagcttgctgctttaggtatccaacaaaaaacaacagttagttgtatacttctaaattgcaattt 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  26954327 tagatactgctgttgttggtcagggaagttcaaccgagcttgctgctttaggtatccaacaaaaaac-acagttagttgtatacttctaaattgcaattt 26954229  T
Q  214 atgcaggtctatctcggacacaatactgaaatatgtggctatattcgactacttat 269  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26954228 atgcaggtctatctcggacacaatactgaaatatgtggctatattcgactacttat 26954173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 35 - 168
Target Start/End: Original strand, 26975976 - 26976109
Alignment:
Q  35 tggaatcaaatgaaggaaattgtgaagtttacaggaccagctatgggattatggttatgtgatccactcatgagcctcatagatactgctgttgttggtc 134  Q
    |||| ||| ||||||||||||||   |||||| ||||| ||||| ||  | ||||||||||  ||  | ||||| ||||| ||||| |||||||||||||    
T  26975976 tggattcagatgaaggaaattgtattgtttactggacctgctattggtctttggttatgtggaccgttgatgagtctcattgataccgctgttgttggtc 26976075  T
Q  135 agggaagttcaaccgagcttgctgctttaggtat 168  Q
    | ||||||||||  || |||||||||||||||||    
T  26976076 aaggaagttcaattgaacttgctgctttaggtat 26976109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 35 - 168
Target Start/End: Complemental strand, 27005930 - 27005797
Alignment:
Q  35 tggaatcaaatgaaggaaattgtgaagtttacaggaccagctatgggattatggttatgtgatccactcatgagcctcatagatactgctgttgttggtc 134  Q
    |||| ||| ||||||||||||||   |||||| ||||| ||||| ||  | ||||||||||  ||  | ||||| ||||| ||||| |||||||||||||    
T  27005930 tggattcagatgaaggaaattgtattgtttactggacctgctattggtctttggttatgtggaccgttgatgagtctcattgatacagctgttgttggtc 27005831  T
Q  135 agggaagttcaaccgagcttgctgctttaggtat 168  Q
    | ||||||||||  || |||||||||||||||||    
T  27005830 aaggaagttcaattgaacttgctgctttaggtat 27005797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 116 - 168
Target Start/End: Complemental strand, 26946526 - 26946474
Alignment:
Q  116 gatactgctgttgttggtcagggaagttcaaccgagcttgctgctttaggtat 168  Q
    |||||||||||| ||||||||||||||||||  ||||||||||||||||||||    
T  26946526 gatactgctgttattggtcagggaagttcaattgagcttgctgctttaggtat 26946474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 104 - 168
Target Start/End: Complemental strand, 26991415 - 26991351
Alignment:
Q  104 atgagcctcatagatactgctgttgttggtcagggaagttcaaccgagcttgctgctttaggtat 168  Q
    ||||| ||||| |||||||||||||||||||| |||||||| |  || |||||||||||||||||    
T  26991415 atgagtctcattgatactgctgttgttggtcaaggaagttcgattgaacttgctgctttaggtat 26991351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University