View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16944_high_10 (Length: 292)

Name: NF16944_high_10
Description: NF16944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16944_high_10
NF16944_high_10
[»] chr4 (1 HSPs)
chr4 (19-62)||(36570838-36570881)
[»] chr1 (1 HSPs)
chr1 (167-216)||(39233688-39233737)
[»] chr3 (1 HSPs)
chr3 (19-65)||(52603725-52603771)


Alignment Details
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 62
Target Start/End: Original strand, 36570838 - 36570881
Alignment:
Q  19 cttcagatctgcattgataaaccctttatttctgtaattttgaa 62  Q
    |||||||||||||||||||||||||||||||||| |||||||||    
T  36570838 cttcagatctgcattgataaaccctttatttctggaattttgaa 36570881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 167 - 216
Target Start/End: Original strand, 39233688 - 39233737
Alignment:
Q  167 atgttatggaaaaattatttcaagatttttgtgtatttactatgtagcta 216  Q
    |||||||||||||||| ||||||||||||||||||||||  |||||||||    
T  39233688 atgttatggaaaaattgtttcaagatttttgtgtatttatcatgtagcta 39233737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 19 - 65
Target Start/End: Complemental strand, 52603771 - 52603725
Alignment:
Q  19 cttcagatctgcattgataaaccctttatttctgtaattttgaatct 65  Q
    |||||||||| |||||||||| |||||||||||| ||||||||||||    
T  52603771 cttcagatctacattgataaaacctttatttctggaattttgaatct 52603725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University