View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16936_low_4 (Length: 309)

Name: NF16936_low_4
Description: NF16936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16936_low_4
NF16936_low_4
[»] chr2 (1 HSPs)
chr2 (14-183)||(7682494-7682662)


Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 14 - 183
Target Start/End: Original strand, 7682494 - 7682662
Alignment:
Q  14 aataattaatgtcgagagtgaacaattggtggatcatgtccaattctcatattgaaagtggtttttgggtaattcgtctagatcctcctggtctgtagaa 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  7682494 aataattaatgtcgagagtgaacaattggtggatcatgtccaattctcatattgaaagtggtttttgggtaattcgtctagatcctcctggtctgta-aa 7682592  T
Q  114 cactcttca---tatttgtttgctcagataaactttagatgattcttgataattttatcttttcggttatgtt 183  Q
      ||| | |    |||| ||||||   ||||||||||| ||||| ||||||||||||||||||||||||||||    
T  7682593 tcctcattaggtgatttttttgct---ataaactttaggtgatttttgataattttatcttttcggttatgtt 7682662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University