View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16931_low_56 (Length: 243)

Name: NF16931_low_56
Description: NF16931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16931_low_56
NF16931_low_56
[»] chr2 (1 HSPs)
chr2 (17-89)||(41469227-41469299)


Alignment Details
Target: chr2 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 17 - 89
Target Start/End: Original strand, 41469227 - 41469299
Alignment:
Q  17 aatttttgtactccattcacattgaaaataaaggacgctttgttttgaaagcgtttcttcttctcttcatctt 89  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  41469227 aatttttgtactccattcacattgaaaataaaggacgctttgttttgaaagtgtttcttcttctcttcatctt 41469299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University