View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16931_high_55 (Length: 233)

Name: NF16931_high_55
Description: NF16931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16931_high_55
NF16931_high_55
[»] chr4 (1 HSPs)
chr4 (19-116)||(48240679-48240776)
[»] chr3 (1 HSPs)
chr3 (19-53)||(9174689-9174723)


Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 48240776 - 48240679
Alignment:
Q  19 aaaatgtcaaaattgtaagatcagacgttatgattggagttcaaacccaacatttacttatgtgtatgaatatataatgtccttgtaatttcatctat 116  Q
    |||||||||||||||||||||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48240776 aaaatgtcaaaattgtaagatcagacgttatgatcggagtttaaatccaacatttacttatgtgtatgaatatataatgtccttgtaatttcatctat 48240679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 53
Target Start/End: Complemental strand, 9174723 - 9174689
Alignment:
Q  19 aaaatgtcaaaattgtaagatcagacgttatgatt 53  Q
    |||||||||||||||| ||||||||||||||||||    
T  9174723 aaaatgtcaaaattgttagatcagacgttatgatt 9174689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University