View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16930_high_17 (Length: 279)

Name: NF16930_high_17
Description: NF16930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16930_high_17
NF16930_high_17
[»] chr7 (1 HSPs)
chr7 (20-158)||(18696673-18696810)


Alignment Details
Target: chr7 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 20 - 158
Target Start/End: Complemental strand, 18696810 - 18696673
Alignment:
Q  20 atctgcaaaatctttacatgaataaataccatacataatccataccatgaatacaaaactattaaaaactatcaatgtgcatactataaatgattattat 119  Q
    ||||||||||||||||||||||||||||||||| ||||| |  | ||||||||||||||||||||||  ||| |||||||||||||||||||||||||||    
T  18696810 atctgcaaaatctttacatgaataaataccatatataattctcatcatgaatacaaaactattaaaat-tattaatgtgcatactataaatgattattat 18696712  T
Q  120 agggaaatttttagttcttaatataattgccagtgctag 158  Q
    |||||||||||||||||||||||||||||| ||||||||    
T  18696711 agggaaatttttagttcttaatataattgctagtgctag 18696673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University