View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16929_low_25 (Length: 360)

Name: NF16929_low_25
Description: NF16929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16929_low_25
NF16929_low_25
[»] chr7 (2 HSPs)
chr7 (78-199)||(33688743-33688864)
chr7 (16-63)||(33688875-33688918)


Alignment Details
Target: chr7 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 78 - 199
Target Start/End: Complemental strand, 33688864 - 33688743
Alignment:
Q  78 gttcataatatttatgcttagaaattatgttatgatccttgttagattaataagatgcgaaaacatgtagtagatgcagcaacaaaagcagagatgcctg 177  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33688864 gttcataatatttatgcttagaaattatgttatgatccttgttagattaataagatgcgaaaacatgtagtagatgcagcaacaaaagcagagatgcctg 33688765  T
Q  178 caatatatacgatgttttaatc 199  Q
    || |||||||||||||||||||    
T  33688764 cagtatatacgatgttttaatc 33688743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 16 - 63
Target Start/End: Complemental strand, 33688918 - 33688875
Alignment:
Q  16 tgaacatcccatgcactagttatgctttatatatctctttagctttga 63  Q
    |||||||||||||||||||||||||||    |||||||||||||||||    
T  33688918 tgaacatcccatgcactagttatgctt----tatctctttagctttga 33688875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University