View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16927_low_13 (Length: 236)

Name: NF16927_low_13
Description: NF16927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16927_low_13
NF16927_low_13
[»] chr7 (1 HSPs)
chr7 (39-220)||(32048543-32048724)


Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 39 - 220
Target Start/End: Original strand, 32048543 - 32048724
Alignment:
Q  39 tatactgtggaagagagaccataaattgatagacattaatttatttatttttaaaaatactaagggaactatcaatcctctaactaacatacatttaaag 138  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||||    
T  32048543 tatactgtggaagagagaccataaattgatagacattaattaatttatttttaaaaatactaagggaactatcgatcatttaactaacatacatttaaag 32048642  T
Q  139 taaactataaaacaaaagttgcctcgttagcatcttattcacgagaagaaaattttattgttaataagatataaattgatgt 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  32048643 taaactataaaacaaaagttgcctcgttagcatcttattcacgagaagaaaaatttattgttaataagatataaattgatgt 32048724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University