View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16921_low_33 (Length: 241)

Name: NF16921_low_33
Description: NF16921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16921_low_33
NF16921_low_33
[»] chr5 (2 HSPs)
chr5 (98-227)||(22016230-22016363)
chr5 (15-100)||(22016398-22016483)


Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 98 - 227
Target Start/End: Complemental strand, 22016363 - 22016230
Alignment:
Q  98 agctagaggtggattgaaactcaggcagctttt-ccaacacggtatgtatatgctaggagggaaaacaactgaacaacaacaaaaccttttcttactagt 196  Q
    ||||||||||||||||||||||||||||||||| ||||||| ||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  22016363 agctagaggtggattgaaactcaggcagctttttccaacacagtacgtacatgctaggagggaaaacaactgaacaacaacaaaaccttttctcactagt 22016264  T
Q  197 gggcttaactaca---atcaaaacctgtcataaa 227  Q
     ||||||||||||   ||||||||||||| ||||    
T  22016263 cggcttaactacagccatcaaaacctgtcttaaa 22016230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 22016483 - 22016398
Alignment:
Q  15 actattaaagccatatttctagaggatgtgaaactaaagtcaaaacacactcttcacaccagcacaacaaagatactagaggaagc 100  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22016483 actattaaagccatatttctagatgatgtgaaactaaagtcaaaacacactcttcacaccagcacaacaaagatactagaggaagc 22016398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University