View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16919_low_33 (Length: 209)

Name: NF16919_low_33
Description: NF16919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16919_low_33
NF16919_low_33
[»] chr4 (2 HSPs)
chr4 (96-191)||(43529727-43529822)
chr4 (21-51)||(43529867-43529897)


Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 96 - 191
Target Start/End: Complemental strand, 43529822 - 43529727
Alignment:
Q  96 tgcaatcccagcaatagctccactggaaagtgaagacgaagatgatcctcgcttaaacaccggtaaatttgtcgtgttcaactctttcaaactccc 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43529822 tgcaatcccagcaatagctccactggaaagtgaagacgaagatgatcctcgcttaaacaccggtaaatttgtcgtgttcaactctttcaaactccc 43529727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 51
Target Start/End: Complemental strand, 43529897 - 43529867
Alignment:
Q  21 ttctcttctttttcgccaacgaaaatataat 51  Q
    |||||||||||||||||||||||||||||||    
T  43529897 ttctcttctttttcgccaacgaaaatataat 43529867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University