View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16916_high_14 (Length: 212)

Name: NF16916_high_14
Description: NF16916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16916_high_14
NF16916_high_14
[»] chr5 (1 HSPs)
chr5 (16-195)||(7542383-7542562)


Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 195
Target Start/End: Original strand, 7542383 - 7542562
Alignment:
Q  16 caaaatcatcattaaggaggttatgtccaaacatagacaaagaagatggattggaaactgttcttgaaatacctatacctgaagaaatgttttcaaacat 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7542383 caaaatcatcattaaggaggttatgtccaaacatagacaaagaagatggattggaaactgttcttgaaatacctatacctgaagaaatgttttcaaacat 7542482  T
Q  116 gggaagtaatgtgacattaagatggcaaaatatgttaacatggatgaaggctcaaactgaggataaattgtcttccccta 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7542483 gggaagtaatgtgacattaagatggcaaaatatgttaacatggatgaaggctcaaactgaggataaattgtcttccccta 7542562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University