View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16912_low_89 (Length: 204)

Name: NF16912_low_89
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16912_low_89
NF16912_low_89
[»] chr1 (1 HSPs)
chr1 (80-186)||(45651069-45651175)


Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 80 - 186
Target Start/End: Complemental strand, 45651175 - 45651069
Alignment:
Q  80 atgtagatctgattggatttgaatccatagatctaatttaaaactcacataaacaattatggaacaactgaaacataaattttgcttataattcataaaa 179  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  45651175 atgtagatctgattggatttgaatccatagatctaatttaaaactcacataaacaattatggaacaactaaaacataaattttgcttataattcataaaa 45651076  T
Q  180 catgaaa 186  Q
    |||||||    
T  45651075 catgaaa 45651069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University