View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16912_low_45 (Length: 330)

Name: NF16912_low_45
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16912_low_45
NF16912_low_45
[»] chr1 (3 HSPs)
chr1 (221-322)||(45724594-45724695)
chr1 (93-188)||(45724724-45724819)
chr1 (32-64)||(45724853-45724885)


Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 221 - 322
Target Start/End: Complemental strand, 45724695 - 45724594
Alignment:
Q  221 caatcacataaagtgctcatgaaataattttacgtatgtgtctgtgtggattggatggtatcgtataacgtatgtatatactataaatgatttatgatga 320  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45724695 caatcacataaagtgctcatgaaataattttacgtatgtgtctgtgtggattggatggtatcgtataacgtatgtatatactataaatgatttatgatga 45724596  T
Q  321 tg 322  Q
    ||    
T  45724595 tg 45724594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 93 - 188
Target Start/End: Complemental strand, 45724819 - 45724724
Alignment:
Q  93 gcagtgatacaactcagttaatttcttttccctataaaattacccactcatgggaattctcttttggtcgtggtctaatgctatcattagttgtac 188  Q
    ||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45724819 gcagtgatacaactctgttaatttcttttccctagaaaattacccactcatgggaattctcttttggtcgtggtctaatgctatcattagttgtac 45724724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 32 - 64
Target Start/End: Complemental strand, 45724885 - 45724853
Alignment:
Q  32 ttactgcatgaatcggtgtactgcactgcatgc 64  Q
    |||||||||||||||||| ||||||||||||||    
T  45724885 ttactgcatgaatcggtgcactgcactgcatgc 45724853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University