View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1690_low_68 (Length: 248)

Name: NF1690_low_68
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1690_low_68
NF1690_low_68
[»] chr2 (1 HSPs)
chr2 (5-239)||(19292120-19292350)


Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 5 - 239
Target Start/End: Original strand, 19292120 - 19292350
Alignment:
Q  5 gaggagatgtcctaaatgcaaattctatgttgccaaatctttaggcagtaactacatgacatgcaggttgcctttctatttaatcttctcttgctttgcg 104  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19292120 gaggagatgtcctaaatgcaaattctatgttgccaaatctctaggcagtaactacatgacatgcaggttgcctttctatttaatcttctcttgctttgcg 19292219  T
Q  105 atcgatttcctgaatatataatattaaacaataattagggcaattttcaatctaaagagggactaaaatgagcaataagtttcaattttagtaacatgag 204  Q
    ||    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19292220 at----ttcctgaatatataacattaaacaataattagggcaattttcaatctaaagagggactaaaatgagcaataagtttcaattttagtaacatgag 19292315  T
Q  205 acaagagagagtttagtgaagctttcaatattatt 239  Q
    |||||||||||||||||||||||||||||||||||    
T  19292316 acaagagagagtttagtgaagctttcaatattatt 19292350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University