View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16905_low_39 (Length: 234)

Name: NF16905_low_39
Description: NF16905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16905_low_39
NF16905_low_39
[»] chr1 (1 HSPs)
chr1 (18-211)||(2040275-2040468)


Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 2040275 - 2040468
Alignment:
Q  18 atgaatatcagatccaagatgcagcaaccacttctttttcatgaatattgagtaaaatggtggggatttagggttgcaattgttggacttgggttatgta 117  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  2040275 atgaatattagatccaagatgcagcaaccacttctttttcatgaatattgagtaaaatggtggggatttagggttgcaattgttggactttggttatgta 2040374  T
Q  118 agtttaatatagaatgctataaaaactgaaataggttgcacatagaaaatgcaaaaatcacatttttgtcgtcattcaaaattaagaagcgtta 211  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  2040375 agttaaatatagaatgctataaaaactgaaataggttgcacatagaaaatgcaaaaatcacattgttgtcgtcattcaaaattaagaagcgtta 2040468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University