View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16905_low_33 (Length: 273)

Name: NF16905_low_33
Description: NF16905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16905_low_33
NF16905_low_33
[»] chr2 (1 HSPs)
chr2 (24-265)||(3945448-3945689)


Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 24 - 265
Target Start/End: Complemental strand, 3945689 - 3945448
Alignment:
Q  24 agtagtaactcttgtgatgtgaatcttccattctcaaggttcaatatctctagactctcaacaagttcaggttatgattttcagcctcagatgaatacta 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3945689 agtagtaactcttgtgatgtgaatcttccattctcaaggttcaatatctctagactctcaacaagttcaggttatgattttcagcctcagatgaatacta 3945590  T
Q  124 ttggattaggcttttcatccgggtttacgtccagtgaagccaatgatcataatggttatacaaatggatttacttcaagatatggttcaatctttagttc 223  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3945589 ttggattaggcttttcatctgggtttacgtccagtgaagccaatgatcataatggttatacaaatggatttacttcaagatatggttcaatctttagttc 3945490  T
Q  224 ttcttctgtaccaagtaatgcatcagttatgccctctctgct 265  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  3945489 ttcttctgtaccaagtaatgcatcagttatgccttctctgct 3945448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University