View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16904_low_84 (Length: 255)

Name: NF16904_low_84
Description: NF16904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16904_low_84
NF16904_low_84
[»] chr1 (1 HSPs)
chr1 (90-238)||(11859292-11859437)


Alignment Details
Target: chr1 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 90 - 238
Target Start/End: Complemental strand, 11859437 - 11859292
Alignment:
Q  90 taactctttattcttcttactctttctccgccgtatcaaaaggattttcataccnnnnnnngcattattattttttcctttctctttcacttgattctct 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||   ||||||||||||||||||||||||||||    
T  11859437 taactctttattcttcttactctttctccgccgtatcaaaaggattttcataccaaaaaaagcattatt---ttttcctttctctttcacttgattctct 11859341  T
Q  190 cttaaaaaatattcccttttttagcagaatcattgtcactcacaaccct 238  Q
    ||| |||||||||||||||||||||||||||||||||| ||| ||||||    
T  11859340 cttcaaaaatattcccttttttagcagaatcattgtcattcataaccct 11859292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University