View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16904_low_104 (Length: 210)

Name: NF16904_low_104
Description: NF16904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16904_low_104
NF16904_low_104
[»] chr3 (2 HSPs)
chr3 (11-97)||(49933885-49933971)
chr3 (128-190)||(49933792-49933854)


Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 11 - 97
Target Start/End: Complemental strand, 49933971 - 49933885
Alignment:
Q  11 cgaagaatattttaaggttgctttcttagttgttggtgtacgtatatatgataattgaatctaaaatattattgagttttggcaata 97  Q
    |||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||    
T  49933971 cgaaaaatattttaaggttgctttcttagttgttggtgtacgtagatatgataattgaatcaaaaatattattgagttttggcaata 49933885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 128 - 190
Target Start/End: Complemental strand, 49933854 - 49933792
Alignment:
Q  128 acacattatccttattcaatatcacacttgtcagtggccaggttgactcccagttgcaaataa 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49933854 acacattatccttattcaatatcacacttgtcagtggccaggttgactcccagttgcaaataa 49933792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University