View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16900_low_3 (Length: 214)

Name: NF16900_low_3
Description: NF16900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16900_low_3
NF16900_low_3
[»] chr8 (1 HSPs)
chr8 (15-199)||(19780725-19780909)


Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 199
Target Start/End: Complemental strand, 19780909 - 19780725
Alignment:
Q  15 atgaagggaggaatttggtgtctgcttcagaagatgggagtgtttggatgtgggatgttgagaaaggtgaagtcattatggttttggggaatgatcaaat 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19780909 atgaagggaggaatttggtgtctgcttcagaagatgggagtgtttggatgtgggatgttgagaaaggtgaagtcattatggttttggggaatgatcaaat 19780810  T
Q  115 attaggaagaagatcaacaagaagcattggtgatatgatagtggtcaaagggagtaatgttacaaagggaaatgctagtagtaaa 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19780809 attaggaagaagatcaacaagaagcattggtgatatgatagtggtcaaagggagtaatgttacaaagggaaatgctagtagtaaa 19780725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University