View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16897_high_12 (Length: 345)

Name: NF16897_high_12
Description: NF16897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16897_high_12
NF16897_high_12
[»] chr5 (2 HSPs)
chr5 (93-173)||(41872152-41872230)
chr5 (28-91)||(41872328-41872395)
[»] chr4 (1 HSPs)
chr4 (44-82)||(50183095-50183133)


Alignment Details
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 93 - 173
Target Start/End: Complemental strand, 41872230 - 41872152
Alignment:
Q  93 taataagcaattcttaccccgtctgtgtatgaggaattagcggtctgcagatgcgctttcgggagcagatagagtgtaagg 173  Q
    |||||||||||| |||||| ||  ||||||||||||||| || ||| || |||||||||||||| ||||| ||||||||||    
T  41872230 taataagcaattattaccctgt--gtgtatgaggaattaacgatctacaaatgcgctttcgggatcagatggagtgtaagg 41872152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 28 - 91
Target Start/End: Complemental strand, 41872395 - 41872328
Alignment:
Q  28 gagttatattatccgctgctcttggagttgagg----tatttctttcgctattgaatctcgtctgtct 91  Q
    ||||||||||||| ||| |||||||||||||||    ||||| |||||||||||||||||||| ||||    
T  41872395 gagttatattatctgctactcttggagttgaggtatatatttgtttcgctattgaatctcgtcagtct 41872328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 44 - 82
Target Start/End: Original strand, 50183095 - 50183133
Alignment:
Q  44 tgctcttggagttgaggtatttctttcgctattgaatct 82  Q
    |||||||||||||||||||||||||||| ||||||||||    
T  50183095 tgctcttggagttgaggtatttctttcgttattgaatct 50183133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University