View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1689-Insertion-14 (Length: 272)

Name: NF1689-Insertion-14
Description: NF1689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1689-Insertion-14
NF1689-Insertion-14
[»] chr6 (3 HSPs)
chr6 (133-194)||(27219543-27219604)
chr6 (8-48)||(27579825-27579865)
chr6 (8-57)||(27219391-27219440)


Alignment Details
Target: chr6 (Bit Score: 62; Significance: 7e-27; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 133 - 194
Target Start/End: Original strand, 27219543 - 27219604
Alignment:
Q  133 tgaaaatcactttttattaaaaatagtaatggaccataattgaatattttatgtggaactat 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27219543 tgaaaatcactttttattaaaaatagtaatggaccataattgaatattttatgtggaactat 27219604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 27579865 - 27579825
Alignment:
Q  8 aacttctcaatagtctttgcacaaaatgatccccgagaaat 48  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  27579865 aacttctcaatagtctttgcacaaaatgatccccgagaaat 27579825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 8 - 57
Target Start/End: Original strand, 27219391 - 27219440
Alignment:
Q  8 aacttctcaatagtctttgcacaaaatgatccccgagaaatcacatttag 57  Q
    ||||||||||||||||| |||||||||||||||| |||||| | ||||||    
T  27219391 aacttctcaatagtcttcgcacaaaatgatccccaagaaataatatttag 27219440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University