View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1687_high_73 (Length: 218)

Name: NF1687_high_73
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1687_high_73
NF1687_high_73
[»] chr7 (1 HSPs)
chr7 (18-202)||(39315498-39315680)


Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 39315498 - 39315680
Alignment:
Q  18 agaaatcgattatgaggtgaataatcgaatagttacctgnnnnnnnggagaatttcacgggaaaatgagaattgaaagtaccgtcaccgggaaagggaag 117  Q
    |||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39315498 agaaatcgattatgaggtgaataatcgaatagttacctgaaaaa--ggagaatttcacgggaaaatgagaattgaaagtaccgtcaccgggaaagggaag 39315595  T
Q  118 tgaattggatttgagggagtgaaacggcaacgaacggatgcgctttgcaccttcttttggttatggaccaaatctcttacttcat 202  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39315596 tgaattggatttgagggagtggaacggcaacgaacggatgcgctttgcaccttcttttggttatggaccaaatctcttacttcat 39315680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University