View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1687_high_72 (Length: 219)

Name: NF1687_high_72
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1687_high_72
NF1687_high_72
[»] chr5 (2 HSPs)
chr5 (18-135)||(4616225-4616342)
chr5 (141-208)||(4616308-4616375)


Alignment Details
Target: chr5 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 18 - 135
Target Start/End: Original strand, 4616225 - 4616342
Alignment:
Q  18 taaaacatgtgcaagcccgtgttatgattttagtagaattattataaaattaactgttgttaaagaaatggataatgttgatgaatgtcatgagacttgc 117  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||    
T  4616225 taaaacatgtgcaagcccttgttatgattttagtagaattattataaaattaactgttcttaaagaaatggataatgttgatgaatgtcatgaaacttgc 4616324  T
Q  118 cgtcacgaattcatttaa 135  Q
    ||||||||||| ||||||    
T  4616325 cgtcacgaattgatttaa 4616342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 141 - 208
Target Start/End: Original strand, 4616308 - 4616375
Alignment:
Q  141 aatgtcatgaaacttgccgtcacgaattgatttaacactaataattgtgattggctatttatcatatt 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4616308 aatgtcatgaaacttgccgtcacgaattgatttaacactaataattgtgattggctatttatcatatt 4616375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University