View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1687_high_53 (Length: 256)

Name: NF1687_high_53
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1687_high_53
NF1687_high_53
[»] chr3 (1 HSPs)
chr3 (19-246)||(43817880-43818107)
[»] chr1 (1 HSPs)
chr1 (102-183)||(19873246-19873327)


Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 246
Target Start/End: Original strand, 43817880 - 43818107
Alignment:
Q  19 ataatcttcattagtttgaaataatattatcaatggtttgttgttcttactgtttgcgtgtggttgctagtgtgtgataatacctgctgttctagtttgg 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||    
T  43817880 ataatcttcattagtttgaaataatattatcaatggtttgttgttcttactgtttgcgtgtggttgctggtgtgtgataatacctgctgttctggtttgg 43817979  T
Q  119 tgtgcacagctggagcgtgtagggggctgtttttgaggctttggaatgctcggctgggattagttgggatttttgtggtatgatagtgcatagaggctgt 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||    
T  43817980 tgtgcacagctggagcgtgtagggggctgtttttgaggctttggaatgctcggctgggattagttgggatttttgtgggatgacagtgcatagaggctgt 43818079  T
Q  219 tattagctaatgttctctaattcctttg 246  Q
    ||||||||||||||||||||||||||||    
T  43818080 tattagctaatgttctctaattcctttg 43818107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 183
Target Start/End: Original strand, 19873246 - 19873327
Alignment:
Q  102 ctgctgttctagtttggtgtgcacagctggagcgtgtagggggctgtttttgaggctttggaatgctcggctgggattagtt 183  Q
    |||| ||||| || ||||| |||||  ||||| || ||||||||||||   |||||||||| |||||||||||||| |||||    
T  19873246 ctgcagttctggtgtggtgcgcacaattggagtgtttagggggctgttagcgaggctttggtatgctcggctgggactagtt 19873327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University